Yeast CRISPR Results: CRISPR

Error message

  • Unable to create CTools CSS cache directory. Check the permissions on your files directory.
  • Unable to create CTools CSS cache directory. Check the permissions on your files directory.

(Wikimedia Commons)

RETURN TO YOUR RESULTS       

CRISPR/Cas9 is a way to easily change the DNA of a living thing at a very specific spot (click here for more on DNA). Which means it is a way to change a specific trait or feature of a thing. Yes it is a big deal.

We didn’t used to be able to do that which is why it is a revolutionary technology that has changed the field of genetics. It has made the idea of curing human genetic disease a potential reality. 

But how close are we to actually editing humans? What does this mean for the future of biology?

CRISPR/Cas9 allows us to specifically change DNA. For example, we could change the size of watermelons, we could change the DNA that causes sickle cell anemia, or we could even change the DNA that causes cancer.

To change these different traits, Cas9, the part that does the actual changing, has to find the right gene. A gene is what we call the section of DNA that is the responsible for a specific trait.

Cas9 finds the correct gene by using an address, called a guide. Once it finds the gene, it cuts the DNA in or near the gene. This cut is then fixed by the cell in a way that changes the old gene.

The Cas9 guide relies on a special property of DNA.

DNA has four bases: A, T, C, and G.

These bases like to pair together when making DNA double stranded, but they pair together in a very specific way. A always pairs with T and G always pairs with C.

If we make our guide the exact order of bases that pairs with the instruction we want to change, Cas9 can find the correct spot in the DNA. Once it finds the spot, it can cut the DNA and rely on tools in the cell to fix it.

At The Tech, we used a white board to make the correct guide. We wanted to change the color of yeast from white to red. To do this, we had to change the ADE2 gene (click here to learn more about ADE2).

We know that this sequence of DNA bases is in the ADE2 gene:

                CACAACTCTGGACATTATAC

To make our guide, we want to match each letter in the above sequence with their pair. The first base is a “C” and “C” pairs with “G”. The second base is an “A” and “A” pairs with “T”. Continuing on down the line we get this sequence:

                GTGTTGAGACCTGTAATATG

This isn’t quite true because our guide is RNA and not DNA. The only difference here is that the T’s become U’s.

               GUGUUGAGACCUGUAAUAUG

We can then put Cas9 into the yeast with the second sequence, known as the complementary sequence. This complementary sequence will take Cas9 to the ADE2 gene and cut the DNA.

We can use this exact same approach in many different animals, plants, or fungi. We just have to know the sequence of the gene we want to change so we can make the correct guide. We could even use this to make a giant watermelon!

RETURN TO YOUR RESULTS

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A goes with T, G with C. (Wikimedia Commons)