Why ancestry and relatedness look different in DNA

-A curious adult from New York

November 18, 2016

You’re absolutely right! Since you and your siblings are not identical twins, you almost certainly don’t have the same exact DNA.

DNA tests like Ancestry.com, though, only look at some of your DNA to determine your ancestry. And they look at the parts of your DNA that are more likely to be the same between people from the same parts of the world.

Picture your DNA as a long book. In the old days before computers and modern technology, books were copied by hand. Monks in monasteries carefully transcribed new copies of books, but sometimes they made mistakes.

Imagine that a monk in a monastery in Poland is copying a book and makes a mistake. They then lose the original and use the copied book to make new copies. Now all the copies of that book in the Polish monastery will have that new mistake.

A Mix of Mother and Father

Imagine our monk in Poland who copied his book with a couple of mistakes. Let’s say a bunch of monks from this monastery take a copy of the book and found new monasteries across Poland.

When they get to their new homes, they start diligently copying their manuscripts. And they each make their own monastery-specific mistakes. Now every book in Poland is no longer the same.

Balanced translocation combination kids children

-A curious adult from Florida

November 15, 2016

Great question! Your friend’s doctor is right that there are four combinations for her kids.

This is important to know because two of the combinations might cause problems for the pregnancy and/or the child, and two won’t.

There are three different ways her kids could get a translocation too. There is also one way her kids won’t end up with one.

However, if we delete one S, we change the meaning of the word! Now we’re not talking about a scoop of ice cream or a piece of cake anymore. Instead we’re talking about a place where it hardly ever rains. 

What happens when we add an extra S? We end up with something meaningless. 

There are Four Combinations of Chr1 and Chr2

Now we know what a balanced translocation is and how parents pass on their chromosomes to their children. We have all the information we need to figure out the four combinations the child in question can inherit.

Let’s say a parent has the balanced translocation I showed earlier:

Genetics scoliosis

-A curious adult from Idaho

November 8, 2016

Great question, the answer seems to be yes!  We know that the type of scoliosis you’re asking about is at least partly hereditary. 

There’s much more to the story, though.  As you can probably tell from that sentence, the sideways curvature of the spine that is scoliosis is not that simple to figure out.

Of course this doesn’t tell us if scoliosis is genetic at all. Twins usually develop and grow in the same environment. To see if scoliosis is genetic, we compare the results to fraternal twins. 

Fraternal twins only share about half of their DNA, just like any other siblings.  So if two twins in a fraternal pair and two twins in an identical twin pair have the same percentages, then we know that scoliosis is purely environmental.  But researchers didn’t find this.

Scientists first take a bunch of different people with and without a genetic condition.  Then they look at their genetic make-up.  Then they compare the genetic differences in the people with the condition to the people without the condition. 

Let’s say, everyone in the group with the condition has a certain genetic change.  But no one in the group without the condition has that change. If we have enough people in the study, then we can say that change is important and probably causes the condition.

Genetics of Parry Romberg Syndrome

-A curious adult from the US

November 1, 2016

Mostly no. To date, there is very little evidence that Parry Romberg Syndrome is genetic. 

What Causes it?

There doesn’t seem to be a general “rule” for who gets Parry Romberg Syndrome or why (despite the few genetic studies mentioned above).

But there are some theories.

One theory is that the person’s own body mistakenly attacks the tissue in their face, something called an autoimmune disease. 

Normally your immune system protects you from getting sick by attacking viruses or bacteria. But sometimes, people’s immune systems get confused and attack their own healthy cells instead.

But most of the time physicians won’t operate before the disease has stabilized.  They don’t want to transplant new tissue into a person’s face if it’s going to immediately melt away.

In fact, one surgeon said that of the ~400 facial reconstructive surgeries he completed more than half failed to “stick”.

Schizophrenia gene

-A curious adult from Canada

October 27, 2016

That’s a tricky question because there isn’t just one gene involved in schizophrenia. Turns out there are lots of them and none of them seem to cause the illness on their own.

And like many other complex diseases, genes aren’t the whole story either. The environment and how we live our lives plays a big role too. What a mess!

But despite all of that, we do know that genes do play a role in schizophrenia. Figuring out which genes is the tricky part.

Twin Studies

One of the best ways to tell if a complicated disease is genetic is by looking at identical twins.

Identical twins have the exact same set of DNA. If a disease is 100% genetic, meaning that it’s only due to our genes, then if one twin in a pair has the disease, then the other twin will always have it too.

Same DNA, same genetics, same diseases. Makes sense right?

But wait!

One gene might tell us that we have brown hair. Another gene might tell our bodies to digest the sugar in milk.

It perhaps isn’t surprising then that lots of genes are involved in something as complicated as schizophrenia. Our brain is a complicated thing and interpreting the world around us isn’t easy!

When there are lots of genes contributing a bit towards the risk for getting a disease, patterns are hard to see. Throw in the environment and the ways we live our lives and things get even messier.

FOXP2 evolution human language

-A high school student from South Africa

October 18, 2016

It is hard to say if more research on FOXP2 will help us better figure out when humans started being able to use language. First off, a whole lot has already been done.

For example, we know that FOXP2 is definitely an important gene for human speech. People with a damaged FOXP2 gene struggle to speak clearly.

Why Did Half of the KE Family have Trouble Speaking?

In a 1990 study, scientists researched the British KE family. (The name “KE” is a nickname used to protect their identities.)  Half of the family members have strong speaking disabilities. They mispronounce words such as “spoon” and “blue” by instead saying “boon” and “bu”. The other half of the family is completely fine.

Evolutionary biologists took a look at FOXP2 and found that humans have two unique mutations that separate them from other apes. They estimated that the two changes happened at least a few hundred thousand years ago.

They also found that these changes probably weren’t just due to random chance — they were helping out the people who had them. In other words, these two changes were positively selected for.

When did Human Language Develop?

Genetics of duchenne muscular dystrophy (DMD)

-A curious adult from Kentucky

October 6, 2016

The chances his children will end up with Duchenne muscular dystrophy (DMD) depend on their mother.

If she isn’t a carrier for DMD, then it is unlikely their kids will have the disease. But because their dad has DMD, all of their daughters will be carriers (you’ll see why this is in the next sections).

I have drawn the X’s as much bigger than the Y because that is how it is in real life (see the image to the right to see how big the Y actually is compared to the X). As you can see, the female has two purple X’s and the male has a blue X and a blue Y. I have colored them to make the chromosomes easier to follow. 

I am showing the dystrophin gene as a little rectangle in the upper half of the X. If the gene doesn’t lead to DMD, I have colored it green and if it does, it is red.

Turning Off One X in Women

We said earlier that it was possible for a woman to have mild DMD symptoms. This is because even though she has two X’s, only one works in a cell. This is called X inactivation.

Luckily for women it isn’t always the same X off in each cell (click here for a more detailed description of this). Some cells have one X turned off and the rest have the other one off.

mtDNA and Y-DNA ancestry

-A curious adult from India

September 27, 2016

You heard right! Those two kinds of DNA can tell if you and I share the same relative from tens of thousands of years ago. The rest of our DNA, the autosomal DNA, is only really useful going back 5 or 6 generations.

DNA tests that look at ancestry or relatedness work by looking at changes in DNA over time. Most of your autosomal DNA changes pretty quickly.

DNA Changes over Time

Part of the difference between someone from Africa and someone from Europe has to do with the fact that our DNA can and does change over time. Not a lot but enough to track.

Think of your DNA like a really long book. Centuries ago, before printing presses were invented, books were copied by hand by monks in monasteries. And the monks sometimes made mistakes during copying.

More than One Way to Skin a Cat

Y-DNA and mtDNA are pretty good for answering questions about ancestry. But they have some limitations.

A drawback with Y-DNA and mtDNA comes from how they are handed down between generations.

Since the Y chromosome is passed from father to son, you can only get information about paternal ancestors. A son can trace his Y-DNA back to his father and his father’s brothers and his father’s brother’s son. And back to his father’s father and his brothers and sons and grandsons and so on.

T Haplogroup

-A curious adult from the U.S.

September 30, 2016

First of all, let me congratulate you on being in good company! Thomas Jefferson is also part of haplogroup T!

Haplogroups are just a way of using DNA to figure out where our ancestors came from. People with common ancestors will share some DNA with each other that they will not share with anyone else. So people in the same haplogroup share some of the same DNA which means they share a common ancestor.

The Basics!

Each cell in our bodies carries DNA – a hefty manual for how to make each part of us – from our eye and hair color to our blood type. These instructions are written in a simple alphabet made up of just four letters—A, T, C and G.

So a stretch or sequence of DNA can be read as letters, such as:

ATTCGTCGCGTACTAATTCCCGTGT

The entire human DNA is made up of around 3 billion of these letters! (That’s 3,000,000,000!)

Without looking at many other versions of this specific bit of DNA, it’s hard to say if the red letter started as a G, and a mutation happened to change it to a T, or the other way around.  Or, a third possibility is that it used to be an A, and two different mutations happened to get to our sequences above.

But what we can say for sure is that our versions of this piece of DNA are different at this position. Each haplogroup has specific changes like this that define this category. 

DNA? We Don’t Need No Stinkin’ DNA (to Catch a Criminal)

Anyone who watches crime shows knows one of the best ways to catch a criminal is with DNA. Pull a little of it from some blood left behind at the crime scene, compare it to a database and voila, criminal caught.

Sometimes, though, there isn’t enough DNA or it has degraded so much you can’t get much out of it. Now you’re stuck. Or are you?

new study in PLOS ONE shows how you just might be able to save your case. As long as the criminal left a bit of hair behind that is.

Pages