Schizophrenia gene

-A curious adult from Canada

October 27, 2016

That’s a tricky question because there isn’t just one gene involved in schizophrenia. Turns out there are lots of them and none of them seem to cause the illness on their own.

And like many other complex diseases, genes aren’t the whole story either. The environment and how we live our lives plays a big role too. What a mess!

But despite all of that, we do know that genes do play a role in schizophrenia. Figuring out which genes is the tricky part.

Twin Studies

One of the best ways to tell if a complicated disease is genetic is by looking at identical twins.

Identical twins have the exact same set of DNA. If a disease is 100% genetic, meaning that it’s only due to our genes, then if one twin in a pair has the disease, then the other twin will always have it too.

Same DNA, same genetics, same diseases. Makes sense right?

But wait!

One gene might tell us that we have brown hair. Another gene might tell our bodies to digest the sugar in milk.

It perhaps isn’t surprising then that lots of genes are involved in something as complicated as schizophrenia. Our brain is a complicated thing and interpreting the world around us isn’t easy!

When there are lots of genes contributing a bit towards the risk for getting a disease, patterns are hard to see. Throw in the environment and the ways we live our lives and things get even messier.

FOXP2 evolution human language

-A high school student from South Africa

October 18, 2016

It is hard to say if more research on FOXP2 will help us better figure out when humans started being able to use language. First off, a whole lot has already been done.

For example, we know that FOXP2 is definitely an important gene for human speech. People with a damaged FOXP2 gene struggle to speak clearly.

Why Did Half of the KE Family have Trouble Speaking?

In a 1990 study, scientists researched the British KE family. (The name “KE” is a nickname used to protect their identities.)  Half of the family members have strong speaking disabilities. They mispronounce words such as “spoon” and “blue” by instead saying “boon” and “bu”. The other half of the family is completely fine.

Evolutionary biologists took a look at FOXP2 and found that humans have two unique mutations that separate them from other apes. They estimated that the two changes happened at least a few hundred thousand years ago.

They also found that these changes probably weren’t just due to random chance — they were helping out the people who had them. In other words, these two changes were positively selected for.

When did Human Language Develop?

Genetics of duchenne muscular dystrophy (DMD)

-A curious adult from Kentucky

October 6, 2016

The chances his children will end up with Duchenne muscular dystrophy (DMD) depend on their mother.

If she isn’t a carrier for DMD, then it is unlikely their kids will have the disease. But because their dad has DMD, all of their daughters will be carriers (you’ll see why this is in the next sections).

I have drawn the X’s as much bigger than the Y because that is how it is in real life (see the image to the right to see how big the Y actually is compared to the X). As you can see, the female has two purple X’s and the male has a blue X and a blue Y. I have colored them to make the chromosomes easier to follow. 

I am showing the dystrophin gene as a little rectangle in the upper half of the X. If the gene doesn’t lead to DMD, I have colored it green and if it does, it is red.

Turning Off One X in Women

We said earlier that it was possible for a woman to have mild DMD symptoms. This is because even though she has two X’s, only one works in a cell. This is called X inactivation.

Luckily for women it isn’t always the same X off in each cell (click here for a more detailed description of this). Some cells have one X turned off and the rest have the other one off.

mtDNA and Y-DNA ancestry

-A curious adult from India

September 27, 2016

You heard right! Those two kinds of DNA can tell if you and I share the same relative from tens of thousands of years ago. The rest of our DNA, the autosomal DNA, is only really useful going back 5 or 6 generations.

DNA tests that look at ancestry or relatedness work by looking at changes in DNA over time. Most of your autosomal DNA changes pretty quickly.

DNA Changes over Time

Part of the difference between someone from Africa and someone from Europe has to do with the fact that our DNA can and does change over time. Not a lot but enough to track.

Think of your DNA like a really long book. Centuries ago, before printing presses were invented, books were copied by hand by monks in monasteries. And the monks sometimes made mistakes during copying.

More than One Way to Skin a Cat

Y-DNA and mtDNA are pretty good for answering questions about ancestry. But they have some limitations.

A drawback with Y-DNA and mtDNA comes from how they are handed down between generations.

Since the Y chromosome is passed from father to son, you can only get information about paternal ancestors. A son can trace his Y-DNA back to his father and his father’s brothers and his father’s brother’s son. And back to his father’s father and his brothers and sons and grandsons and so on.

T Haplogroup

-A curious adult from the U.S.

September 30, 2016

First of all, let me congratulate you on being in good company! Thomas Jefferson is also part of haplogroup T!

Haplogroups are just a way of using DNA to figure out where our ancestors came from. People with common ancestors will share some DNA with each other that they will not share with anyone else. So people in the same haplogroup share some of the same DNA which means they share a common ancestor.

The Basics!

Each cell in our bodies carries DNA – a hefty manual for how to make each part of us – from our eye and hair color to our blood type. These instructions are written in a simple alphabet made up of just four letters—A, T, C and G.

So a stretch or sequence of DNA can be read as letters, such as:

ATTCGTCGCGTACTAATTCCCGTGT

The entire human DNA is made up of around 3 billion of these letters! (That’s 3,000,000,000!)

Without looking at many other versions of this specific bit of DNA, it’s hard to say if the red letter started as a G, and a mutation happened to change it to a T, or the other way around.  Or, a third possibility is that it used to be an A, and two different mutations happened to get to our sequences above.

But what we can say for sure is that our versions of this piece of DNA are different at this position. Each haplogroup has specific changes like this that define this category. 

DNA? We Don’t Need No Stinkin’ DNA (to Catch a Criminal)

Anyone who watches crime shows knows one of the best ways to catch a criminal is with DNA. Pull a little of it from some blood left behind at the crime scene, compare it to a database and voila, criminal caught.

Sometimes, though, there isn’t enough DNA or it has degraded so much you can’t get much out of it. Now you’re stuck. Or are you?

new study in PLOS ONE shows how you just might be able to save your case. As long as the criminal left a bit of hair behind that is.

Balanced translocation Down syndrome

-An undergraduate from India

August 31, 2016

In something like 96% of cases, Down syndrome is a random accident. Something happens while an egg is being made and that egg gets fertilized by a sperm. The end result is an extra chromosome 21 and a child with Down syndrome. 

Or, less often, the reverse happens. There is a mix-up when a sperm gets made and this sperm then goes on to fertilize the egg.

DNA Is Packaged in Chromosomes

The instructions for making and running your body are found in long stretches of DNA called chromosomes. Most people have 23 pairs for a total of 46.

We each get one set of 23 chromosomes from mom and the other set of 23 from dad. Here is what this looks like:

Passing Down Chromosomes

When we have a child we pass down one chromosome from each of our pairs. So mom passes down one of her chromosome 1’s one of her 2’s and so on. Dad does the same. In the end the child has two pairs of 23 chromosomes for a total of 46.

Let’s look at this process in a little more detail. I’ll focus on just two pairs:  

Imagine this is mom’s two pairs of chromosomes:

How a mutation can cause a disease

-A high school student from New Jersey

August 16, 2016

To many people the word “mutation” sounds scary or magical. They might think of giant ants attacking Tokyo or the X-men.

It turns out that a mutation isn’t really any of these. It is simply a change in DNA. That’s it.

And they aren’t even all that rare. Mutations happen all the time and you have lots of them.

While not all mutations cause problems, some do. One of these is the DNA change that can lead to sickle cell anemia.

A Mutation in the Hemoglobin Gene Causes Sickle Cell Anemia

As I said, a mutation in the hemoglobin gene causes sickle cell anemia. And what a tiny mutation!

People with sickle cell anemia have a mutation in the hemoglobin that changes a GAG to a GTG.  Sounds harmless enough, but single letter changes can have a big effect.  

Look at this recipe for instance:

“Add the HAM to the soup”

Now imagine we change the “H” in ham to “Y” like so:

“Add the YAM to the soup”

Mutations Make Genetic Diversity

What’s even more amazing is that mutations are absolutely essential for life. They are where all the wonderful differences between you and me and between you and a tuna or a daisy come from. Without them life could not have started and it would not have survived.

You see, mutations are the reason why plants and animals (including people!) can adapt to a changing environment. Let’s look to moths as an example.

Mitochondrial DNA (mtDNA) in fingerprints

-A high school student from the US

August 10, 2016

DNA is often found in human fingerprints. But because there is so little of it there, scientists often need to turn to a certain kind of DNA—mitochondrial DNA (mtDNA).

While mtDNA can’t uniquely identify a human being, it can still help. For example, police can use this DNA to rule out suspects.

Fingerprint Patterns

Before going into why fingerprints have DNA, let’s go over what fingerprints are.

DNA Profiling

After the police get DNA from a crime scene, they use a process called DNA profiling to identify people. 

First, they use a method called PCR to make more copies of the DNA. Next, they can look at spots in the DNA that tend to be different between people. If someone shares a lot of the same spots with the DNA at a crime scene, then chances are good that person was there.

Nuclear DNA

Each cell has a single nucleus, which has the nuclear DNA (nuDNA). NuDNA is organized in structures called chromosomes.

In total, we have 23 pairs of chromosomes, for a total of 46. One from each pair comes from mom and the other from dad. This is why, for the most part, we have two copies of each bit of our nuDNA. 

Henry VIII Kell blood type

-A high school student from Spain

August 4, 2016

Henry VIII is famous for killing off his wives for failing to give him a son. But his wives weren’t just failing to have sons. Instead, hardly any of their children survived after the first one

By chance most of his wives and mistresses had daughters for their first child. And then, thereafter, all of the sons and daughters either were miscarried or died soon after birth.

In today’s world these babies have a better chance at survival. Doctors can often give the babies transfusions soon after birth or even before birth.

And luckily for everyone, being Kell positive is not very common. Over 90% of people are Kell negative.

Still, some kids do suffer from Kell-based HDN today. But this does not have to be forever.  

One day there may be a way to keep this form of HDN from happening. We just need to look at the Rh blood system to see how this might work.

How Kell and Rh Are Similar

Right now there is no equivalent to RhoGAM for moms who are Kell negative and are carrying a Kell positive child. In fact, it isn’t even routinely tested for when people donate blood.

This last point matters because it means that some Kell negative women are given Kell positive blood during a transfusion. Now their immune system reacts to this transfused blood making antibodies that will attack any Kell positive blood they encounter. This is how a woman’s first child might be affected (not a problem in Henry VIII’s time as there were no transfusions).

Pages